| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.215120 |
| Chromosome: | chromosome 6 |
| Location: | 3877337 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278177 | DNL6,LIG6 | (1 of 1) PTHR10459:SF44 - ANKYRIN REPEAT-CONTAINING PROTEIN; DNA ligase 6 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGCTGGGCACGGCATCCAGGCACGGGC |
| Internal bar code: | GATTAGCGAATTATCGCTTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1031 |
| LEAP-Seq percent confirming: | 98.6627 |
| LEAP-Seq n confirming: | 17780 |
| LEAP-Seq n nonconfirming: | 241 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGTTTAAGTAGGCCGAAG |
| Suggested primer 2: | TACTACCAGCGGTGGACACA |