Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.215121 |
Chromosome: | chromosome 12 |
Location: | 3785323 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g515301 | (1 of 4) PF13515 - Fusaric acid resistance protein-like (FUSC_2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCAGCGCAAATTCTGGAACAGCAGCCGC |
Internal bar code: | CTTTCTCTCCGGAAGAAGGTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1051 |
LEAP-Seq percent confirming: | 99.1625 |
LEAP-Seq n confirming: | 20365 |
LEAP-Seq n nonconfirming: | 172 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCAGCAGTAGCAGCAGGA |
Suggested primer 2: | AGAGGTCCCCACTGTTGATG |