| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.215128 |
| Chromosome: | chromosome 12 |
| Location: | 474260 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g493400 | SMC4 | (1 of 1) K06675 - structural maintenance of chromosome 4 (SMC4); Structural Maintenance of Chromosomes protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCTCGATGGCGGTCAGGTCGGGGTTGA |
| Internal bar code: | TAGGGTCGGCGGACCAGAGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 480 |
| LEAP-Seq percent confirming: | 99.5087 |
| LEAP-Seq n confirming: | 27139 |
| LEAP-Seq n nonconfirming: | 134 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGTCTTACCCAGCTGCC |
| Suggested primer 2: | TTCCAACCCCTCTCTTGTTG |