Insertion junction: LMJ.RY0402.215224_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.215224
Chromosome:chromosome_10
Location:1638464
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AGCGGATAGGAACCCAGGGCATCAACACGC
Internal bar code:GGTGCCTCCTGCGCCCGTAGTG

Confirmation - LEAP-Seq

LEAP-Seq distance:1063
LEAP-Seq percent confirming:99.7651
LEAP-Seq n confirming:2124
LEAP-Seq n nonconfirming:5
LEAP-Seq n unique pos:11

Suggested primers for confirmation by PCR

Suggested primer 1:ACTCCTCCAATGTTCCAACG
Suggested primer 2:AAGGGCAATATGCTTCATGG