| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.215339 |
| Chromosome: | chromosome 4 |
| Location: | 366155 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217913 | MCP19 | Mitochondrial substrate carrier protein; (1 of 1) PTHR24089:SF133 - PROTEIN Y37B11A.3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGAGCTGTAGCTTGGTGTGGCGAGTGT |
| Internal bar code: | GTAACATGGCGAAAGAGAAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1125 |
| LEAP-Seq percent confirming: | 99.4885 |
| LEAP-Seq n confirming: | 35403 |
| LEAP-Seq n nonconfirming: | 182 |
| LEAP-Seq n unique pos: | 152 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATGCAAAAGAGCGAGGAG |
| Suggested primer 2: | ATAAACACCGCGAACAGGTC |