Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.215339 |
Chromosome: | chromosome 4 |
Location: | 366155 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217913 | MCP19 | Mitochondrial substrate carrier protein; (1 of 1) PTHR24089:SF133 - PROTEIN Y37B11A.3 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACCGCTAACCTACCACTCGTGGGCACAC |
Internal bar code: | GGAGGAAGCTTCCATGCCAACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 453 |
LEAP-Seq percent confirming: | 99.6223 |
LEAP-Seq n confirming: | 9759 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATGCAAAAGAGCGAGGAG |
Suggested primer 2: | ATAAACACCGCGAACAGGTC |