| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.215362 |
| Chromosome: | chromosome 9 |
| Location: | 6540644 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407801 | AKC1 | (1 of 1) PTHR10566//PTHR10566:SF41 - CHAPERONE-ACTIVITY OF BC1 COMPLEX CABC1 -RELATED // SUBFAMILY NOT NAMED; ABC1/COQ8 ser/thr kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCCTCACATGCCGCCGTACTGCACGCC |
| Internal bar code: | ACCTGGATCATGCCGCGGGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 329 |
| LEAP-Seq percent confirming: | 99.7145 |
| LEAP-Seq n confirming: | 3143 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCAGCCCAAACTAAACCG |
| Suggested primer 2: | GCACTTGCTTTGCCTTTTTC |