| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.215366 |
| Chromosome: | chromosome 13 |
| Location: | 2272495 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g578900 | MOT27 | (1 of 98) IPR023214 - HAD-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAACACTGCGCACCACACCTGCTGCTG |
| Internal bar code: | CAACGCTAGAGAGGCGTCGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 354 |
| LEAP-Seq percent confirming: | 95.0732 |
| LEAP-Seq n confirming: | 714 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGTTTAGTTTGGGCTGG |
| Suggested primer 2: | ATTGCCCTTAGCTCGTCAGA |