| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.215367 |
| Chromosome: | chromosome 12 |
| Location: | 1097430 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g490700 | MIN1 | (1 of 1) IPR000008//IPR018392 - C2 domain // LysM domain; Mini-eyespot protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGCCTCGGCACGCGCACCAACACGTAC |
| Internal bar code: | GGGCTGGCCTCGGCGCTACCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 999 |
| LEAP-Seq percent confirming: | 98.6441 |
| LEAP-Seq n confirming: | 6693 |
| LEAP-Seq n nonconfirming: | 92 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGGACACTCCGAGACAGC |
| Suggested primer 2: | CATGCATGTTGGTGTGATGA |