| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.215368 |
| Chromosome: | chromosome 6 |
| Location: | 5444654 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284350 | CYCD3 | (1 of 1) K18810 - cyclin D1/2/4, plant (CYCD1_2_4); D-type cyclin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCAACTTGTGAGAAACACAATTGCAAAC |
| Internal bar code: | AAAACTCGTCGCAAGCTGTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1096 |
| LEAP-Seq percent confirming: | 97.7136 |
| LEAP-Seq n confirming: | 4231 |
| LEAP-Seq n nonconfirming: | 99 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGCGGCTTGGTTAGTCTC |
| Suggested primer 2: | GTATCAGGTGGTCGGCAAGT |