| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.215382 |
| Chromosome: | chromosome 3 |
| Location: | 1629141 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g152850 | PAM,PAM1 | (1 of 1) 1.14.17.3//4.3.2.5 - Peptidylglycine monooxygenase / Peptidylglycine alpha-amidating monooxygenase // Peptidylamidoglycolate lyase / Alpha-hydroxyglycine amidating dealkylase; bioactive peptide amidating enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTTTGGAGGTCACGGTCATTGCCAGTTT |
| Internal bar code: | AAGCGTTTTACCATATAACTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 796 |
| LEAP-Seq percent confirming: | 91.0229 |
| LEAP-Seq n confirming: | 5597 |
| LEAP-Seq n nonconfirming: | 552 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCTGATGCAGGACAAGAA |
| Suggested primer 2: | CGACCACCCGTTGCTATACT |