| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.215403 |
| Chromosome: | chromosome 17 |
| Location: | 4446077 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g732100 | SSA4 | cilia-sensing, structure and/or assembly; (1 of 1) PTHR21439//PTHR21439:SF0 - OXIDORED-NITRO DOMAIN-CONTAINING PROTEIN // PROTEIN OSCP1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGAACCGTCTAGACAACCTGGTGCCCTG |
| Internal bar code: | GTCCTGTGCAAGCCAGCTTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 289 |
| LEAP-Seq percent confirming: | 99.0924 |
| LEAP-Seq n confirming: | 8953 |
| LEAP-Seq n nonconfirming: | 82 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTGTCCGGTCCTTGTTGT |
| Suggested primer 2: | GCCAGCGCTCTATGTCCTAC |