| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.215437 |
| Chromosome: | chromosome 8 |
| Location: | 2656377 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g373100 | CYP97C3,CYP25 | Cytochrome P450, CYP97 superfamily; (1 of 1) 1.14.99.45 - Carotene epsilon-monooxygenase / LUT1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGAGAGAGGGGTGGCGTCAAAGAGGCAG |
| Internal bar code: | GTTTTGTTTTAAGTTTGTGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 397 |
| LEAP-Seq percent confirming: | 99.4661 |
| LEAP-Seq n confirming: | 8570 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGCAACGGTTTGTAAGGG |
| Suggested primer 2: | TTCACTCGCGAAGGTGTATG |