Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.215484 |
Chromosome: | chromosome 12 |
Location: | 3826240 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g515400 | (1 of 17) PF08016 - Polycystin cation channel (PKD_channel) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGACTGCAGAGGTACCAGGAGAGGACTCC |
Internal bar code: | GGATGGTCCAGCGGCACCAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 910 |
LEAP-Seq percent confirming: | 97.5283 |
LEAP-Seq n confirming: | 2762 |
LEAP-Seq n nonconfirming: | 70 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTCCTACCACATGCACCAA |
Suggested primer 2: | TTGGACTTTGTCGATTGCAG |