| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.215488 |
| Chromosome: | chromosome 4 |
| Location: | 3860386 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g230144 | SPT1 | Component of serine palmitoyltransferase; (1 of 1) PTHR13693//PTHR13693:SF3 - CLASS II AMINOTRANSFERASE/8-AMINO-7-OXONONANOATE SYNTHASE // LD36009P | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGACGATCCCATTTCCAGTTGCTCTGG |
| Internal bar code: | CGACCACTGTACGCTTTCGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 604 |
| LEAP-Seq percent confirming: | 99.6017 |
| LEAP-Seq n confirming: | 9002 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTGAGGGTTTTGAGCAGC |
| Suggested primer 2: | ATGTGAAGGCCTACATTCGC |