| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.215532 |
| Chromosome: | chromosome 3 |
| Location: | 7646545 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g204150 | FAP167,IFT80 | Intraflagellar transport protein 80; (1 of 1) PTHR24098//PTHR24098:SF0 - FAMILY NOT NAMED // OSEG5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGTTCATGGAGAACGGACGGGGGTTGGC |
| Internal bar code: | TCAGCGATGGGACTGCCCACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 564 |
| LEAP-Seq percent confirming: | 99.8341 |
| LEAP-Seq n confirming: | 3009 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTCGCTCTTTCGCATAC |
| Suggested primer 2: | TGTGCTATGTGGAGAGCAGG |