| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.215556 |
| Chromosome: | chromosome 17 |
| Location: | 3191081 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722000 | MFT30,SOC1 | Major facilitator superfamily transporter; (1 of 1) K08214 - MFS transporter, OCT family, solute carrier family 22 (organic cation transporter), member 18 (SLC22A18) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAACGTGCAAGGACAAGTGTGGACCAAGC |
| Internal bar code: | GCTTAAAGTGCAGTTTCGCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 980 |
| LEAP-Seq percent confirming: | 99.445 |
| LEAP-Seq n confirming: | 12902 |
| LEAP-Seq n nonconfirming: | 72 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAGGGAGGCAGTACATGG |
| Suggested primer 2: | GTGCATGTATGCGTCAGCTT |