| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.215697 |
| Chromosome: | chromosome 17 |
| Location: | 3411249 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g724150 | DRP3 | (1 of 1) K17065 - dynamin 1-like protein (DNM1L); Dynamin-related GTPase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCCTGCCTCGTGGCAATGACATCGTCA |
| Internal bar code: | AGCGGGCGACCGAGTTGTATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 859 |
| LEAP-Seq percent confirming: | 99.6706 |
| LEAP-Seq n confirming: | 9986 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTAAGCTCGACCTCCCTCAA |
| Suggested primer 2: | ACAGCAACACTGGTACACGC |