| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.215722 |
| Chromosome: | chromosome 1 |
| Location: | 48361 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000200 | (1 of 33) IPR013830 - SGNH hydrolase-type esterase domain; Esterase, SGNH hydrolase-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTGGCGGCCGGGTCGGGCGTTGGGCGA |
| Internal bar code: | GAGTGTCGGGCAATTAGTACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 537 |
| LEAP-Seq percent confirming: | 99.752 |
| LEAP-Seq n confirming: | 12069 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCTCATACAGCAGGAGTG |
| Suggested primer 2: | ATACGCACACAGTAGCACGC |