| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.215810 |
| Chromosome: | chromosome 17 |
| Location: | 3452099 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g724700 | PAO3,Tic55-like3,TIC55-3,PAO1 | Pheophorbide a oxygenase-related protein; (1 of 3) K13071 - pheophorbide a oxygenase (PAO, ACD1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATCCGGTCGGGAAGGTGGAGGACCTGGA |
| Internal bar code: | TTGCGTTCGTCTCCCCGGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 710 |
| LEAP-Seq percent confirming: | 98.8176 |
| LEAP-Seq n confirming: | 1170 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCTCCAGTAGTTGCAGGC |
| Suggested primer 2: | TCCATAGGGATCTGGACAGC |