| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.215895 |
| Chromosome: | chromosome 3 |
| Location: | 7974300 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201900 | RSP1 | (1 of 1) PTHR23084//PTHR23084:SF172 - PHOSPHATIDYLINOSITOL-4-PHOSPHATE 5-KINASE RELATED // SUBFAMILY NOT NAMED; Radial spoke protein 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTTGGATAGGGCGAGGGGGGTTGGAAG |
| Internal bar code: | CGGACAACCTGGCACCAAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 460 |
| LEAP-Seq percent confirming: | 84.6792 |
| LEAP-Seq n confirming: | 7351 |
| LEAP-Seq n nonconfirming: | 1330 |
| LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTACATTTCCAGAGCACA |
| Suggested primer 2: | TTTAGGAAGGGCTGCGACTA |