Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.215955 |
Chromosome: | chromosome 11 |
Location: | 3313311 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g480200 | (1 of 4) IPR006597 - Sel1-like repeat | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATCGGTGACGCAGGGCAGAGGGCGGAAT |
Internal bar code: | TGTACTATTTGTGCTTCTACAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 665 |
LEAP-Seq percent confirming: | 98.7565 |
LEAP-Seq n confirming: | 1509 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCTTGAAGTGGGGGTAGT |
Suggested primer 2: | ATGTCCGTAGGCACTGGAAC |