| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.215998 |
| Chromosome: | chromosome 5 |
| Location: | 616739 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g232000 | (1 of 1) IPR001623//IPR011989 - DnaJ domain // Armadillo-like helical | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCCGAGGCGTGTAACTGCAAGGGGCT |
| Internal bar code: | ATCTCCAGGCCTACGCAGCAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 762 |
| LEAP-Seq percent confirming: | 93.6256 |
| LEAP-Seq n confirming: | 13498 |
| LEAP-Seq n nonconfirming: | 919 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTGGGCCTATGTGTTAAA |
| Suggested primer 2: | GTCATCGGTACGCACAACAC |