| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.216010 |
| Chromosome: | chromosome 7 |
| Location: | 4332494 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g341300 | XAP5 | (1 of 1) K13119 - protein FAM50 (FAM50, XAP5); transcription factor controlling ciliary gene expression | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCCGGGCGTGCCGAAGCCACACGCCAGC |
| Internal bar code: | CGTACAGTTATGCCCGATGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 751 |
| LEAP-Seq percent confirming: | 99.7606 |
| LEAP-Seq n confirming: | 12086 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCGTGTCACGTACCCCTA |
| Suggested primer 2: | GCTCATTTAAGGGCTTGCAG |