| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.216059 |
| Chromosome: | chromosome 9 |
| Location: | 7860904 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g416850 | POB32 | Proteome of basal body 32; (1 of 3) IPR000104//IPR001763 - Antifreeze protein, type I // Rhodanese-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTCAAGTTATGGACGGGGCCCAATGCA |
| Internal bar code: | GCGGAACTTCCAGTGGGGGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 864 |
| LEAP-Seq percent confirming: | 99.4757 |
| LEAP-Seq n confirming: | 21060 |
| LEAP-Seq n nonconfirming: | 111 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCAGCGTACTGGCTTTTC |
| Suggested primer 2: | GGCAACGGTAATGGCAAC |