Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.216210 |
Chromosome: | chromosome 2 |
Location: | 8723567 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g142266 | CYP97A5 | Cytochrome P450, CYP97 superfamily; (1 of 2) K15747 - beta-ring hydroxylase (LUT5, CYP97A3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAACGCGGATTTAACGCGGTAACTTTCAC |
Internal bar code: | AGACTTGACCCGGTCCGACGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1027 |
LEAP-Seq percent confirming: | 99.6571 |
LEAP-Seq n confirming: | 3488 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTTGGCAACATAGCACCTT |
Suggested primer 2: | GCGAGCAGGGATAGTGAGTC |