| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.216216 |
| Chromosome: | chromosome 2 |
| Location: | 5676714 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g109800 | CPLD32,FAO3 | conserved FAD dependent oxidoreductase; (1 of 1) PTHR13847//PTHR13847:SF184 - FAD NAD BINDING OXIDOREDUCTASES // FAD-DEPENDENT OXIDOREDUCTASE-LIKE PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGTAGTATGAGGGCAGGGCTGGCCTTA |
| Internal bar code: | CTGCTCGGTCCGCACGTAGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 836 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGACTTGATAGTGCGGGTA |
| Suggested primer 2: | ACACAACGGTGACCTCTTCC |