Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.216337 |
Chromosome: | chromosome 17 |
Location: | 4644304 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g733250 | FKB16D,FKB16-4,FKB7 | (1 of 1) PTHR10516:SF323 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP16-4, CHLOROPLASTIC; peptidyl-prolyl cis-trans isomerase, FKBP-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCATCTGGCCACCCAGCAACCACACCA |
Internal bar code: | TTCGGCAAGTTCATACTAAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1206 |
LEAP-Seq percent confirming: | 97.449 |
LEAP-Seq n confirming: | 191 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAATGCTTTACCGTGAACCG |
Suggested primer 2: | GTACGGTAGCAACGGTTCGT |