Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.216377 |
Chromosome: | chromosome 9 |
Location: | 4154057 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g393954 | FAP106 | Flagellar Associated Protein 106; (1 of 1) PTHR21490:SF0 - ENKURIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCATCCATAGGACGAAACTGAGCTGACA |
Internal bar code: | GAGGGGTGCACTTGAGGGCATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 963 |
LEAP-Seq percent confirming: | 99.6565 |
LEAP-Seq n confirming: | 2321 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTATTGGTGTGCGTGTGGTC |
Suggested primer 2: | CGTTGAGTGTGGACAGTGCT |