| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.216429 |
| Chromosome: | chromosome 8 |
| Location: | 4680076 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383702 | UBC38 | (1 of 2) K10586 - baculoviral IAP repeat-containing protein 6 (apollon) (BIRC6, BRUCE); E2 ubiquitin conjugating enzyme | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACCAGCGCCTCAAGTGGTGGCCGCGATGA |
| Internal bar code: | ACGCTCCGCTGGCATGTAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 328 |
| LEAP-Seq percent confirming: | 33.913 |
| LEAP-Seq n confirming: | 117 |
| LEAP-Seq n nonconfirming: | 228 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCAAACACTGCCCCAACT |
| Suggested primer 2: | CTGTTTCCACGGTTTCCATT |