Insertion junction: LMJ.RY0402.216498_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.216498
Chromosome:chromosome_17
Location:3201536
Confidence (%):95
Locus systematic id Locus common name Defline Orientation Feature
Cre17.g722150 PKS3 Type III polyketide synthase sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CAGCACAGTACCCTCCCCGCGCGGAATGGT
Internal bar code:GGCGGCTTCCTCCGAACCCCGT

Confirmation - LEAP-Seq

LEAP-Seq distance:0
LEAP-Seq percent confirming:0.0
LEAP-Seq n confirming:0
LEAP-Seq n nonconfirming:221
LEAP-Seq n unique pos:0

Suggested primers for confirmation by PCR

Suggested primer 1:ATGAGGAAACAGGCTGTGCT
Suggested primer 2:CACTTGCATGGTGGGTACTG