Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.216503 |
Chromosome: | chromosome 1 |
Location: | 835505 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g004300 | ASNS,ASN1 | (1 of 1) K01953 - asparagine synthase (glutamine-hydrolysing) (asnB, ASNS); Asparagine synthase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGCGTTGTGCTTGTCACTTCCCAGTACA |
Internal bar code: | CATGTACCTTGCTCTCGCCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 395 |
LEAP-Seq percent confirming: | 70.1657 |
LEAP-Seq n confirming: | 127 |
LEAP-Seq n nonconfirming: | 54 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACCCAAATGCGTTCACCT |
Suggested primer 2: | GAAATGGTGCAACAGGAGGT |