Insertion junction: LMJ.RY0402.216590_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.216590
Chromosome:chromosome_9
Location:6540644
Confidence (%):73
Locus systematic id Locus common name Defline Orientation Feature
Cre09.g407801 AKC1 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGGGGGTGAGGCAGGCAGATGTGAGGGGG
Internal bar code:GCGGTACTCCCATGGATGGGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:948
LEAP-Seq percent confirming:99.8241
LEAP-Seq n confirming:6241
LEAP-Seq n nonconfirming:11
LEAP-Seq n unique pos:34

Suggested primers for confirmation by PCR

Suggested primer 1:TACCAGCCCAAACTAAACCG
Suggested primer 2:GCACTTGCTTTGCCTTTTTC