Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.216628 |
Chromosome: | chromosome 12 |
Location: | 7676550 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554250 | LPB1 | (1 of 1) PTHR11952:SF8 - UDP-GLUCOSE PYROPHOSPHORYLASE 3; Low Photochemical Bleaching protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAATTGTGCCCAAGACGCAACCTCGGCCC |
Internal bar code: | GGGATGGCCATCCTCTCGCTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 296 |
LEAP-Seq percent confirming: | 84.6512 |
LEAP-Seq n confirming: | 364 |
LEAP-Seq n nonconfirming: | 66 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTTGCTCGATTCTCCAAC |
Suggested primer 2: | CGGTTTACTTTGGGCTGGTA |