Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.216634 |
Chromosome: | chromosome 3 |
Location: | 2486082 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g159650 | EFG6 | (1 of 1) PTHR23115//PTHR23115:SF96 - TRANSLATION FACTOR // SUBFAMILY NOT NAMED; Putative organellar translation elongation factor EFG/EF2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAACCTGAGTGGAACTAAAGCCGCGCTG |
Internal bar code: | TTAAGCCGAACGATCCGTCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 944 |
LEAP-Seq percent confirming: | 99.6375 |
LEAP-Seq n confirming: | 4398 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGATGCCTGTGGTTAGGT |
Suggested primer 2: | TAGCTGTCTGGTGCCATCTG |