| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.216636 |
| Chromosome: | chromosome 6 |
| Location: | 6755220 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g294700 | DIV152 | (1 of 6) PF01477 - PLAT/LH2 domain (PLAT) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTGCTTCTTCACGCCGCTGAACCGCTGC |
| Internal bar code: | GATCACGCAGAAGCGAACGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 544 |
| LEAP-Seq percent confirming: | 99.8285 |
| LEAP-Seq n confirming: | 582 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCCACTGATCTTGTTGGC |
| Suggested primer 2: | CTCCTGCACCTGGCTAGAAG |