| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.216697 |
| Chromosome: | scaffold 50 |
| Location: | 7263 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre50.g761447 | (1 of 1) K03500 - 16S rRNA (cytosine967-C5)-methyltransferase [EC:2.1.1.176] (rsmB, sun) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTGTGTTTCGTGGCTGGACAGAGGAGGC |
| Internal bar code: | CGGTCCCCCCTGCTATCCTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 963 |
| LEAP-Seq percent confirming: | 99.6618 |
| LEAP-Seq n confirming: | 2947 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACAGCAGATCGAGTCAAGC |
| Suggested primer 2: | CCTCTGTCCGTACGTGTGTG |