| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.216703 |
| Chromosome: | chromosome 9 |
| Location: | 4117150 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393654 | RLS11 | RegA/Rls-like protein; (1 of 10) IPR010919 - SAND domain-like | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCGCCCGAAGCGGTCACCAGGATGGTTT |
| Internal bar code: | AAGGGAGTCGTAGGTAGAAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 433 |
| LEAP-Seq percent confirming: | 99.8745 |
| LEAP-Seq n confirming: | 2388 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTACTCGAGCCCATCACTC |
| Suggested primer 2: | GCTTTCAACCACTTCTTCGC |