Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.216758 |
Chromosome: | chromosome 12 |
Location: | 7595932 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g555050 | MUS81,CJE1 | (1 of 1) PTHR13451:SF0 - CROSSOVER JUNCTION ENDONUCLEASE MUS81; Crossover junction endonuclease | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCTTGGCTCCGACGAACCCTCTTGACGA |
Internal bar code: | GTCTGTCAACGACAACGCGATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 175 |
LEAP-Seq percent confirming: | 92.3077 |
LEAP-Seq n confirming: | 4680 |
LEAP-Seq n nonconfirming: | 390 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGATTCACAACCCCTTTTT |
Suggested primer 2: | GCTTTGACCAGCGTTTTCTC |