| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.216766 |
| Chromosome: | chromosome 14 |
| Location: | 1464143 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g618000 | EFH9 | EF-hand Calcium binding protein; (1 of 5) PTHR23050:SF90 - CENTRIN-3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGAACGCCTCCAGACCGCCCCCGATCCAG |
| Internal bar code: | CACGTTTGGTGAGCACGTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 689 |
| LEAP-Seq percent confirming: | 99.353 |
| LEAP-Seq n confirming: | 7985 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTATGCTATGGGCCTGGT |
| Suggested primer 2: | GTCCCCTTCCTCTCCTGTTC |