| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.216810 |
| Chromosome: | chromosome 12 |
| Location: | 7246476 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558250 | SNR7,TML1 | Regulatory R-SNARE protein, Tomsyn/Sro family (R.Reg); (1 of 1) PTHR10241 - LETHAL 2 GIANT LARVAE PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGTGCCCGGCGCCTTCCCCAGCGCCTAC |
| Internal bar code: | CCCGACAGGGTGGGGGGTTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1001 |
| LEAP-Seq percent confirming: | 99.7768 |
| LEAP-Seq n confirming: | 1788 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGTATCCAACCCAAATG |
| Suggested primer 2: | CGGTTCTTTGCTCAGACTCC |