| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.216854 |
| Chromosome: | scaffold 36 |
| Location: | 14102 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre36.g759647 | (1 of 4) 3.1.3.24 - Sucrose-phosphate phosphatase / Sucrose-6-phosphate phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCGCCGATGCCCCCGCGGGCAGCGCCG |
| Internal bar code: | GTCCACTTTCCTCGGGACCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 720 |
| LEAP-Seq percent confirming: | 98.8078 |
| LEAP-Seq n confirming: | 4061 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGCTTAAGAGCTGTCGGG |
| Suggested primer 2: | CTTGCACCATGACCACAAAC |