| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.216961 |
| Chromosome: | chromosome 10 |
| Location: | 2264984 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434350 | CTR2 | CTR type copper ion transporter; (1 of 2) PTHR12483//PTHR12483:SF27 - SOLUTE CARRIER FAMILY 31 COPPER TRANSPORTERS // COPPER TRANSPORTER 1A, ISOFORM C-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCTTGCGGCGGCGTCATCCGAGAAGCC |
| Internal bar code: | TGAATCGTTATGGCTAAGACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 954 |
| LEAP-Seq percent confirming: | 99.5683 |
| LEAP-Seq n confirming: | 3690 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACCGGAAGCAAACATAGG |
| Suggested primer 2: | TGAAGCGTGAATAAACAGCG |