| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.216965 |
| Chromosome: | chromosome 8 |
| Location: | 587155 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g359567 | (1 of 44) IPR000048 - IQ motif, EF-hand binding site | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCCCAGTTCCCACTCCTTAGCTGCGAG |
| Internal bar code: | AGGTCGGAGTTCCCCGTGCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 798 |
| LEAP-Seq percent confirming: | 92.4198 |
| LEAP-Seq n confirming: | 9766 |
| LEAP-Seq n nonconfirming: | 801 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGATTAGTGTCCACACGCT |
| Suggested primer 2: | GCTGCTTCTGATGACGACAA |