| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.217184 |
| Chromosome: | chromosome 5 |
| Location: | 2888047 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g238000 | (1 of 3) IPR006502//IPR011705 - Protein of unknown function PDDEXK-like // BTB/Kelch-associated | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTAGCCGAGCATCAAATCTATGCCTCTG |
| Internal bar code: | TGCCCCTCCGCCCGCTTGGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 791 |
| LEAP-Seq percent confirming: | 99.537 |
| LEAP-Seq n confirming: | 8170 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAAGCGTCGTAGTGTGGCT |
| Suggested primer 2: | AGAGTAGCAATGATGCCGCT |