| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.217216 |
| Chromosome: | chromosome 16 |
| Location: | 2811202 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663150 | (1 of 7) 2.8.1.1 - Thiosulfate sulfurtransferase / Thiosulfate thiotransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCAGCCTCCGCCTGCCCACCATCGGAG |
| Internal bar code: | TCTAACAGGGTCAGGTCACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1004 |
| LEAP-Seq percent confirming: | 96.6292 |
| LEAP-Seq n confirming: | 86 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAGCTATTCGGTGTGGGT |
| Suggested primer 2: | CGGAAGAGAGAGTGTGGGAG |