Insertion junction: LMJ.RY0402.217256_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.217256
Chromosome:chromosome_2
Location:5089307
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g104900 FAP204 Flagellar Associated Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GTCGGGGCGCCCAGCAAACGCATTTTGTTC
Internal bar code:TCAGGACTCTAGACAGATCTCA

Confirmation - LEAP-Seq

LEAP-Seq distance:575
LEAP-Seq percent confirming:96.4623
LEAP-Seq n confirming:818
LEAP-Seq n nonconfirming:30
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GGGAAGTTGCGTTGATGAAT
Suggested primer 2:GAGAGCATATGAACGCACGA