| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.217266 |
| Chromosome: | chromosome 4 |
| Location: | 3390186 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227500 | SRR18 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 2) IPR001190//IPR006626//IPR011050//IPR017448 - SRCR domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor // SRCR-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTCCTAAACATGAGAGTCGTAATGGGAG |
| Internal bar code: | GGCCTCGAATAGTTGGGAGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 642 |
| LEAP-Seq percent confirming: | 92.8709 |
| LEAP-Seq n confirming: | 4807 |
| LEAP-Seq n nonconfirming: | 369 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGGGTGGCGTCAGTTAT |
| Suggested primer 2: | AAACTTTGCCGGAATGAATG |