| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.217270 |
| Chromosome: | chromosome 12 |
| Location: | 1788572 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g512200 | MFT26 | Major facilitator superfamily transporter; (1 of 1) PTHR23504//PTHR23504:SF15 - FAMILY NOT NAMED // PROTEIN ZINC INDUCED FACILITATOR 1-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGTGTGCGTCCTCAAACGGGTGGACAGT |
| Internal bar code: | GTACAGGCCAGGGGAGGCGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 505 |
| LEAP-Seq percent confirming: | 91.553 |
| LEAP-Seq n confirming: | 1745 |
| LEAP-Seq n nonconfirming: | 161 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAGCCACAGCGACAGCAG |
| Suggested primer 2: | GGTACGACCAGGGAGGAAAT |