| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.217331 |
| Chromosome: | chromosome 13 |
| Location: | 3908725 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g590550 | COA5,COAD1 | (1 of 1) 2.7.7.3 - Pantetheine-phosphate adenylyltransferase / PPAT; Pantetheine-phosphate adenylyltransferase, CoA biosynthesis | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACAACGCTTGCTTCTTGCCTTACACTCC |
| Internal bar code: | CATTGGCCAGTTGCAAGTACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 581 |
| LEAP-Seq percent confirming: | 98.5572 |
| LEAP-Seq n confirming: | 888 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGCGCAGTATTAGATCA |
| Suggested primer 2: | GTTGCTGCTTGGCCTTTTAG |